Regulation of the Intercellular Adhesin Locus Regulator (icaR) by SarA, , and IcaR in Staphylococcus aureus

The proteins encoded by the intercellular adhesin genes (icaADBC) synthesize the polysaccharide poly-N-acetylglucosamine (PNAG), which contributes to the formation of a biofilm by Staphylococcus aureus. In addition to the proteins that synthesize PNAG, the ica locus also encodes the TetR family transcriptional regulator IcaR (23). The icaR gene is transcribed divergently from icaADBC (10) and is a negative regulator of icaADBC expression (9, 14). Biofilm formation by S. aureus plays an important role in the pathogenesis of endocarditis, osteomyelitis, and corneal and medical device infections (18). Although the majority of clinical isolates of S. aureus contain the ica operon, in vitro expression is tightly controlled (19) and the regulation of ica has been shown to be a complex and multifactorial process, involving a variety of external environmental factors and internal regulators. Rachid et al. demonstrated that B was required for biofilm formation under environmental stress conditions in an S. aureus mucosal isolate (22). They suggested that the effect of B on ica expression could be indirect, as the ica promoter does not appear to contain a consensus B binding site. Later, Conlon et al. demonstrated that icaR encodes a repressor of icaADBC transcription in Staphylococcus epidermidis, and we found the same to be true in S. aureus (9, 14). Alleviation of IcaR-mediated repression occurs in response to certain icaADBC-inducing stimuli such as ethanol but not in response to others (e.g., NaCl) (8), suggesting a role for additional regulatory mechanisms. Valle et al. and Beenken et al. demonstrated a role for SarA in icaADBC expression and biofilm formation in S. aureus (2, 27), and shortly thereafter Tormo et al. demonstrated a similar role in S. epidermidis (26). While negative regulation of icaR by B in S. epidermidis has been shown previously (16), its regulation in S. aureus has not yet been studied. IcaR belongs to the tetracycline repressor family of proteins, which are involved in gene regulation, acting as either transcriptional activators or repressors. The aim of this work was to elucidate regulation of the icaR gene in S. aureus. All strains used in this study were grown at 37°C and 200 rpm in Luria-Bertani (LB) broth or LB agar, except for biofilm formation assays, where tryptic soy broth supplemented with 1% glucose was used. When appropriate, LB broth or LB agar was supplemented with the antibiotics at the following concentrations: 10 g chloramphenicol/ml, 5 g tetracycline/ml, and 10 g erythromycin/ml. After overnight growth, cultures were diluted 1:50 in 5 ml fresh medium and incubated for 6 h before cells were collected for expression studies. Using DNA from strain S. aureus MN8 as the template and the primers IcaRpro EcoRI (5 -GAATTCTAGTATTTTAATTTGCAATAGATT GTTGTTATAATTAAACGG-3 ) and IcaRproSma (5 -CCCG GGCTTATCCTTCAATTTTTATAACCCC-3 ), we amplified the promoter region and the first four codons of the icaR gene by PCR, and using the primers icapro1932 (5 -GAATTCGATATA AAGCATCAATTGAATAGTTCG-3 ) and icaproREV (5 -CC CGGGGTTAAAAAATTGCAATTTCTTTACCTTTCG-3 ), we amplified the icaADBC promoter and the first six codons of icaA. The DNA fragments were digested with SmaI, fused to the -galactosidase gene (bgaB) from Bacillus stearothermophilus, and cloned into the staphylococcal shuttle vector pRB473 (constructed by Reinhold Brückner, Universitat Tubingen, Germany) (4). The reporter construct was sequenced to verify the absence of mutations, electroporated into S. aureus RN4220, and transduced to other strains using phage 80 (15, 17). S. aureus strain Newman rsbUVW, in which the B operon has been replaced with an erythromycin resistance (Erm) cassette, was kindly provided by Kenneth Bayles, University of Nebraska (24). Strain ALC1342, a derivative of strain RN6390 in which the sarA gene was replaced with an Erm cassette, was kindly provided by Ambrose Cheung, Dartmouth Medical School (7). RN4220 icaR::Erm was constructed previously in our lab (14). Mutations were transduced to strains SA113 and Newman using phage 80. To complement the deletion mutations, sarA and 1.2 kb of the region upstream from the gene, which contains the promoters and a 5 untranslated region; the rsbUVW B locus; or the icaR gene was amplified from genomic DNA from strain Newman using the primer pairs attB2SarAFWD (5 -GGGGACCACTTTGTACAAGAAAGCT GGGTCTATATCATTGGTGTCCTAGTTGG-3 ) and attB1 SarAREV (5 -GGGGACAAGTTTGTACAAAAAAGCAGGC ATGGATTGGATGGTAATTTAGCTGG-3 ); attB2SigBFWD (5 -GGGGACCACTTTGTACAAGAAAGCTGGGTGGAAT CAATTGGAGGTTCTCATATG-3 ) and attB1SigBREV (5 -G GGGACAAGTTTGTACAAAAAAGCAGGCCTTTACGTTT * Corresponding author. Mailing address: Virginia Commonwealth University, Department of Microbiology and Immunology, P.O. Box 980678, Richmond, VA 23928. Phone: (804) 828-9699. Fax: (804) 8289946. E-mail: [email protected]. Published ahead of print on 25 July 2008.